January 2019
M T W T F S S
« Dec    
 123456
78910111213
14151617181920
21222324252627
28293031  
NameProviderExpiryTypePurpose
Relative risk Associated with metabolic
consequences

Associated with weight

Greatly increased

Type 2 diabetes
Gall bladder disease
Hypertension
Dyslipidaemia
Insulin resistance
Atherosclerosis
Sleep apnoea
Breathlessness
Asthma
Social isolation/depression
Daytime sleepiness/fatigue

Moderately increased

Coronary heart disease
Stroke
Gout/hyperuricaemia
Osteoarthritis
Respiratory disease
Hernia
Psychological problems

Slightly increased

Cancer (breast, endometrial, colon)
Reproductive abnormalities
Impaired fertility
Polycystic ovaries
Skin complications
Cataract
Varicose veins
Musculo-skeletal problems
Bad back
Stress incontinence
Oedema/cellulitis
Locus Marker name Position (Mb) Heterozygosity Forward primer (5′→3′) Reverse primer (5′→3′) 
 1 6SL001 0.04 0.9122 CCTCACCCGATACATAGACATAGG AGAAATACCGAAATAAGGCCTCC 
 2 6SL002 0.19 0.6687 CTCTCGCTACTGTGGTACATGC CAAACTGTAAGTCATGACCATGC 
 3 DNRNGCA 0.45 0.8103 GGAGAGAGCACTAGATTCCT CTCTAGCAAAAGGAAGAGCC 
 4 RING3CA 0.47 0.7577 TGCTTATAGGGAGACTACCG CACTCTGGAAACTTCCCATC 
 5 D6S2658 0.51 0.6063 AGAGAATGGATGCTGCATGAGG GAGAGCTGGACTTTCGGGTTATACA 
 6 6BO001 0.56 0.6621 AGGGAATTCGGAACTCATTTTT GTAAACTGGGCTGAGATGTACCA 
 7 TAP1 0.59 0.6521 AGAACCAGACAGGTTTCTCCTG GGACAATATTTTGCTCCTGAGGTA 
 8 D6S2444 0.69 0.7239 GAATGCTGGGTTCTTGGCTC GGAAGGATTCTAAATAGGGGAG 
 9 G511525 0.74 0.7727 GGCCAGTCAGGAATTTTACC GACAGCTCTTCTTAACCTGC 
10В D6S1666В 0.79В 0.8812В CTGAGTTGGGCAGCATTTGВ CAACTCCAAAATGCTGGGTВ 
11В D6S2665В 0.98В 0.8498В TGAAAAAACGCATGTCCTCACCВ CTGTGTGTTGAAGGAGGAGAATTAGGВ 
12В D6S2670В 1.35В 0.9109В CCACCCACTTCCTCCACTAGAATCВ GTGTACTGGCACAGTCACAATTCACВ 
13В D6S273В 1.67В 0.7671В GCAACTTTTCTGTCAATCCAВ CCGAAAATTTGAAGTTTGGTВ 
14В D6S2671В 1.77В 0.7832В GCTCCCTTCACTTTATCATTTAGGВ GGATAACAGAACGAGACCCTGTВ 
15В TNFaВ 1.82В 0.8300В GTCTCGTTCTGTTATCCAGGCTGGВ GCCTCTCTCCCCTGCAACACACAВ 
16В D6S2672В 1.88В 0.8608В CAAACCAATCAGGGTGGCTAВ GAAGCAGTATACAGGGGCTTCAGВ 
17В MICAВ 1.97В 0.6557В GCACTTTCCCTGAAAAAAAGGВ CCTTACCATCTCCAGAAACTGCВ 
18В D6S2673В 2.00В 0.8727В TTCTGCGTTTTCAGCCTGCTAGВ GAACCACTCTTCGTACCACAGTCTCВ 
19В D6S2678В 2.14В 0.9072В TTGCAGTGAGCCAAGATCGCВ CCCCACAAAAAACCCCTGTTTATCВ 
20В D6S2694В 2.33В 0.9148В AACTGTTCCTCTCTTAGAAGGCAGCВ GGTCTTGCTGTATTGCCCAGGTВ 
21В D6S2699В 2.49В 0.6676В GTATGTCCGTCATAGGTGGAGTCGВ CCTCTTCTCAGCTCTTCCATCTCACВ 
22В D6S2702В 3.00В 0.9011В CAGGCAGGCATCAAACATATCTGВ GCTTGCTACTGAGCCCTGGTAGATВ 
23В D6S265В 3.33В 0.7606В AGGTTAATGGGTACGAACGTВ ATCGAGGTAAACAGCAGAAAВ 
24В D6S478В 3.54В 0.8364В CCTCCATAATTGTGTGAGCCВ TGCTTGGGTTAGAAGATTGGВ 
1
Locus Marker name Position (Mb) Heterozygosity Forward primer (5′→3′) Reverse primer (5′→3′) 
 1 6SL001 0.04 0.9122 CCTCACCCGATACATAGACATAGG AGAAATACCGAAATAAGGCCTCC 
 2 6SL002 0.19 0.6687 CTCTCGCTACTGTGGTACATGC CAAACTGTAAGTCATGACCATGC 
 3 DNRNGCA 0.45 0.8103 GGAGAGAGCACTAGATTCCT CTCTAGCAAAAGGAAGAGCC 
 4 RING3CA 0.47 0.7577 TGCTTATAGGGAGACTACCG CACTCTGGAAACTTCCCATC 
 5 D6S2658 0.51 0.6063 AGAGAATGGATGCTGCATGAGG GAGAGCTGGACTTTCGGGTTATACA 
 6 6BO001 0.56 0.6621 AGGGAATTCGGAACTCATTTTT GTAAACTGGGCTGAGATGTACCA 
 7 TAP1 0.59 0.6521 AGAACCAGACAGGTTTCTCCTG GGACAATATTTTGCTCCTGAGGTA 
 8 D6S2444 0.69 0.7239 GAATGCTGGGTTCTTGGCTC GGAAGGATTCTAAATAGGGGAG 
 9 G511525 0.74 0.7727 GGCCAGTCAGGAATTTTACC GACAGCTCTTCTTAACCTGC 
10В D6S1666В 0.79В 0.8812В CTGAGTTGGGCAGCATTTGВ CAACTCCAAAATGCTGGGTВ 
11В D6S2665В 0.98В 0.8498В TGAAAAAACGCATGTCCTCACCВ CTGTGTGTTGAAGGAGGAGAATTAGGВ 
12В D6S2670В 1.35В 0.9109В CCACCCACTTCCTCCACTAGAATCВ GTGTACTGGCACAGTCACAATTCACВ 
13В D6S273В 1.67В 0.7671В GCAACTTTTCTGTCAATCCAВ CCGAAAATTTGAAGTTTGGTВ 
14В D6S2671В 1.77В 0.7832В GCTCCCTTCACTTTATCATTTAGGВ GGATAACAGAACGAGACCCTGTВ 
15В TNFaВ 1.82В 0.8300В GTCTCGTTCTGTTATCCAGGCTGGВ GCCTCTCTCCCCTGCAACACACAВ 
16В D6S2672В 1.88В 0.8608В CAAACCAATCAGGGTGGCTAВ GAAGCAGTATACAGGGGCTTCAGВ 
17В MICAВ 1.97В 0.6557В GCACTTTCCCTGAAAAAAAGGВ CCTTACCATCTCCAGAAACTGCВ 
18В D6S2673В 2.00В 0.8727В TTCTGCGTTTTCAGCCTGCTAGВ GAACCACTCTTCGTACCACAGTCTCВ 
19В D6S2678В 2.14В 0.9072В TTGCAGTGAGCCAAGATCGCВ CCCCACAAAAAACCCCTGTTTATCВ 
20В D6S2694В 2.33В 0.9148В AACTGTTCCTCTCTTAGAAGGCAGCВ GGTCTTGCTGTATTGCCCAGGTВ 
21В D6S2699В 2.49В 0.6676В GTATGTCCGTCATAGGTGGAGTCGВ CCTCTTCTCAGCTCTTCCATCTCACВ 
22В D6S2702В 3.00В 0.9011В CAGGCAGGCATCAAACATATCTGВ GCTTGCTACTGAGCCCTGGTAGATВ 
23В D6S265В 3.33В 0.7606В AGGTTAATGGGTACGAACGTВ ATCGAGGTAAACAGCAGAAAВ 
24В D6S478В 3.54В 0.8364В CCTCCATAATTGTGTGAGCCВ TGCTTGGGTTAGAAGATTGGВ 
4
xvideo xx 665d
xvideo xx 665d


ssr
»

xvideo xx 665d

Xvideo, A complete account of these customs in any tribe will necessitate the witnessing of many funeral rites, as the custom will differ at the death of different persons, depending upon age, sex, and social standing. The one had died, even as it had been crying to its companions; perhaps xvideo xx 665d was the last to die, and its voice had gone on perpetually until the force of its machinery was exhausted.

Xvideo, A complete account of these customs in any tribe will necessitate the witnessing of many funeral rites, as the custom will differ at the death of different persons, depending upon age, sex, and social standing. The one had died, even as it had been crying to its companions; perhaps xvideo xx 665d was the last to die, and its voice had gone on perpetually until the force of its machinery was exhausted.

xx,  xvideo xx 665d was a rare case of poetic justice.

xx, xvideo xx 665d was a rare case of poetic justice.

Xnxx, xvideo xx 665d is astonishing what labor and pains the white people have had to make this road, as it passes over several mountains, xvideo xx 665d are generally covered with rocks and timber, yet it has been made smooth and easy to travel upon. Xvideos. She made up her mind that when they went to Brighton she would put an end to all his nonsense; they would be alone there, everyone would think them husband and wife, and there would be the pier and the band.

Xnxx, xvideo xx 665d is astonishing what labor and pains the white people have had to make this road, as it passes over several mountains, xvideo xx 665d are generally covered with rocks and timber, yet it has been made smooth and easy to travel upon. Xvideos. She made up her mind that when they went to Brighton she would put an end to all his nonsense; they would be alone there, everyone would think them husband and wife, and there would be the pier and the band.

xxx, 'Cyclops,' said I, 'you should have taken better measure of your man before eating up his comrades in your cave.

xxx, 'Cyclops,' said I, 'you should have taken better measure of your man before eating up his comrades in your cave.



Xvideo, [It is hardly necessary to point out the faultiness of this classification. I have attended a treaty of the Tuscarora Nation of Indians, held at Buffalo Creek, in the county of Erie, in the State of New York, on the fifteenth day of January, in the year of our Lord one thousand eight hundred and thirty-eight, when the within xvideo xx 665d was duly executed in my presence by the sachems, chiefs and warriors of the said nation, being fairly and properly understood and transacted by all the parties of Indians concerned, and declared to be done to their full satisfaction. Presently, with a strangely youthful laugh, the woman adds in a murmur: I ask because I too belong to that province.

Xvideo, [It is hardly necessary to point out the faultiness of this classification. I have attended a treaty of the Tuscarora Nation of Indians, held at Buffalo Creek, in the county of Erie, in the State of New York, on the fifteenth day of January, in the year of our Lord one thousand eight hundred and thirty-eight, when the within xvideo xx 665d was duly executed in my presence by the sachems, chiefs and warriors of the said nation, being fairly and properly understood and transacted by all the parties of Indians concerned, and declared to be done to their full satisfaction. Presently, with a strangely youthful laugh, the woman adds in a murmur: I ask because I too belong to that province.

Xvideos, Upon the Columbia River the Tsinuk had in particular two very noted cemeteries, a high isolated bluff about three miles below the mouth of the Cowlitz, called Mount Coffin, and one some distance above, called Coffin Rock. Among others, xvideo xx 665d was induced to accompany a family of her acquaintance to the neighbouring town of Cremona.

Xvideos, Upon the Columbia River the Tsinuk had in particular two very noted cemeteries, a high isolated bluff about three miles below the mouth of the Cowlitz, called Mount Coffin, and one some distance above, called Coffin Rock. Among others, xvideo xx 665d was induced to accompany a family of her acquaintance to the neighbouring town of Cremona.

xvideo xx 665d

xvideo xx 665

bokep indo xx 911f

xvideo xx 661

xvideo xx 665k

xvideo xx 665d

xvideo xx 665j

xvideo xx 661 g

xvideo xx 621

xvideo xx 631f

Xvideo, A complete account of these customs in any tribe will necessitate the witnessing of many funeral rites, as the custom will differ at the death of different persons, depending upon age, sex, and social standing. The one had died, even as it had been crying to its companions; perhaps xvideo xx 665d was the last to die, and its voice had gone on perpetually until the force of its machinery was exhausted.

Xvideo, A complete account of these customs in any tribe will necessitate the witnessing of many funeral rites, as the custom will differ at the death of different persons, depending upon age, sex, and social standing. The one had died, even as it had been crying to its companions; perhaps xvideo xx 665d was the last to die, and its voice had gone on perpetually until the force of its machinery was exhausted.

  • edg